Digital language has been developed using binary code (i.e. the bits 0 and 1) with the sole differentiating property being the bit value (0/1). Each bit has no more information content than the bit value (0/1). A bit 0 is no different from any other bit 0 (irrespective of context) and a bit 1 is no different from any other bit 1 (again, irrespective of context) – i.e. there are no context specifications for bits. A string in digital language (e.g. 001010101010110110101110101101111110010110101010111) thus has no “higher dimensional” information content other than its 1-dimensional “composition” of 0s and 1s.
This is apparently contrary to the “Language of Life“. Take DNA for instance – all DNA is coded for by 4 “bits” – A/T/G/C, In this case, each “bio bit” has a rich array of distinguishing physicochemical properties – for instance, A/T/G/C have different molecular weights, chemical structures, substitution propensities, and reactivities. Thus each of these “bio bits” has a rich set of associated properties that distinguish it from each of the other bits – unlike the digital bits 0 and 1 that differ purely by their bit value. The rich array of differing physicochemical properties of the ATGC biobits in turn enables genetic information content of DNA to be encoded in dimensions higher than the 1-D sequence –
for instance each gene (e.g. ATGCTGATGCTGATGCTAGGAGATCGGAGCTGCGCGATTAGAGGCGCGCGTTACATCTA) has in addition to its 1-D sequence, secondary (2-D) and tertiary (3-D) structures that are enabled by inter-bit interactions that stem from their finely defined and rich array of physicochemical properties. There are further dimensions involving structural interactions and networks of such interactions as well – but this builds on the same richness in fundamental bit diversity – contrary to digital language wherein complexity stems from string usage, interpretation, modification, and interactions without actually expanding on the potential richness in bit diversity.
Food for thought: if one were to look into biomimetic digital bit expansion, how would one go about that? We look forward to our reader’s thoughts on this subject.
From Bytes to Biology 